Skip to content

ProfoundAdvice

Answers to all questions

Menu
  • Home
  • Trendy
  • Most popular
  • Helpful tips
  • Life
  • FAQ
  • Blog
  • Contacts
Menu

What is the mRNA of TTA?

Posted on June 4, 2021 by Author

Table of Contents

  • 1 What is the mRNA of TTA?
  • 2 How wide is DNA?
  • 3 What is mRNA translation?
  • 4 What is the complementary three nucleotide sequence in the appropriate tRNA?
  • 5 What is the sequence of the mRNA?

What is the mRNA of TTA?

Amino Acid Coding DNA Strand Base Triplets Not Transcribed Transfer RNA Anticodons Complementary To M-RNA Codons
leucine TTA, TTG, CTT, CTC CTA, CTG AAU, AAC, GAA, GAG GAU, GAC
lysine AAA, AAG UUU, UUC
methionine (start) ATG UAC
phenylalanine TTT, TTC AAA, AAG

What is the amino acid sequence of TTA?

Codon-Amino Acid Abbreviations

Codon Full Name Abbreviation (3 Letter)
TTT Phenylalanine Phe
TTC Phenylalanine Phe
TTA Leucine Leu
TTG Leucine Leu

How wide is DNA?

A DNA strand is a long, thin molecule—averaging only about two nanometers (or two billionths of a meter) in width. That is so thin, that a human hair is about 40,000 times as wide.

What amino acid is UGA?

READ:   Is there anything else that I can help you with today?

The results show that UAA, like UAG, directs the incorporation of glutamine, whereas UGA directs the incorporation of three amino acids, arginine, cysteine, and tryptophan. To our knowledge, this is the first report indicating misreading of UAA as glutamine and UGA as arginine and cysteine in higher eukaryotes.

What is mRNA translation?

Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a sequence of amino acids during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding amino acid sequence that it encodes.

What is the size of RNA?

According to the length of RNA chain, RNA includes small RNA and long RNA. Usually, small RNAs are shorter than 200 nt in length, and long RNAs are greater than 200 nt long.

What is the complementary three nucleotide sequence in the appropriate tRNA?

The anticodon is the complementary three nucleotide sequence in the appropriate tRNA. b. Template strand is the DNA strand off which the mRNA is synthesized. The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

READ:   What is the strongest type of bow?

What is the corresponding anti-codon to the mRNA sequence?

The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’ (the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T) d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’ 2.

What is the sequence of the mRNA?

The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’ (the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

How to find transcript sequences for a gene?

National Center for Biotechnology Information. How to: Find transcript sequences for a gene. Starting with A GENE NAME, PRODUCT NAME, OR SYMBOL. Search the Gene database with the gene name, symbol. Click on the desired gene. Click on Reference Sequences in the Table of Contents at the upper right of the gene record.

READ:   Should I mix music with headphones or monitors?

Popular

  • Can DBT and CBT be used together?
  • Why was Bharat Ratna discontinued?
  • What part of the plane generates lift?
  • Which programming language is used in barcode?
  • Can hyperventilation damage your brain?
  • How is ATP made and used in photosynthesis?
  • Can a general surgeon do a cardiothoracic surgery?
  • What is the name of new capital of Andhra Pradesh?
  • What is the difference between platform and station?
  • Do top players play ATP 500?

Pages

  • Contacts
  • Disclaimer
  • Privacy Policy
© 2025 ProfoundAdvice | Powered by Minimalist Blog WordPress Theme
We use cookies on our website to give you the most relevant experience by remembering your preferences and repeat visits. By clicking “Accept All”, you consent to the use of ALL the cookies. However, you may visit "Cookie Settings" to provide a controlled consent.
Cookie SettingsAccept All
Manage consent

Privacy Overview

This website uses cookies to improve your experience while you navigate through the website. Out of these, the cookies that are categorized as necessary are stored on your browser as they are essential for the working of basic functionalities of the website. We also use third-party cookies that help us analyze and understand how you use this website. These cookies will be stored in your browser only with your consent. You also have the option to opt-out of these cookies. But opting out of some of these cookies may affect your browsing experience.
Necessary
Always Enabled
Necessary cookies are absolutely essential for the website to function properly. These cookies ensure basic functionalities and security features of the website, anonymously.
CookieDurationDescription
cookielawinfo-checkbox-analytics11 monthsThis cookie is set by GDPR Cookie Consent plugin. The cookie is used to store the user consent for the cookies in the category "Analytics".
cookielawinfo-checkbox-functional11 monthsThe cookie is set by GDPR cookie consent to record the user consent for the cookies in the category "Functional".
cookielawinfo-checkbox-necessary11 monthsThis cookie is set by GDPR Cookie Consent plugin. The cookies is used to store the user consent for the cookies in the category "Necessary".
cookielawinfo-checkbox-others11 monthsThis cookie is set by GDPR Cookie Consent plugin. The cookie is used to store the user consent for the cookies in the category "Other.
cookielawinfo-checkbox-performance11 monthsThis cookie is set by GDPR Cookie Consent plugin. The cookie is used to store the user consent for the cookies in the category "Performance".
viewed_cookie_policy11 monthsThe cookie is set by the GDPR Cookie Consent plugin and is used to store whether or not user has consented to the use of cookies. It does not store any personal data.
Functional
Functional cookies help to perform certain functionalities like sharing the content of the website on social media platforms, collect feedbacks, and other third-party features.
Performance
Performance cookies are used to understand and analyze the key performance indexes of the website which helps in delivering a better user experience for the visitors.
Analytics
Analytical cookies are used to understand how visitors interact with the website. These cookies help provide information on metrics the number of visitors, bounce rate, traffic source, etc.
Advertisement
Advertisement cookies are used to provide visitors with relevant ads and marketing campaigns. These cookies track visitors across websites and collect information to provide customized ads.
Others
Other uncategorized cookies are those that are being analyzed and have not been classified into a category as yet.
SAVE & ACCEPT