Table of Contents
What is the mRNA of TTA?
| Amino Acid | Coding DNA Strand Base Triplets Not Transcribed | Transfer RNA Anticodons Complementary To M-RNA Codons |
|---|---|---|
| leucine | TTA, TTG, CTT, CTC CTA, CTG | AAU, AAC, GAA, GAG GAU, GAC |
| lysine | AAA, AAG | UUU, UUC |
| methionine (start) | ATG | UAC |
| phenylalanine | TTT, TTC | AAA, AAG |
What is the amino acid sequence of TTA?
Codon-Amino Acid Abbreviations
| Codon | Full Name | Abbreviation (3 Letter) |
|---|---|---|
| TTT | Phenylalanine | Phe |
| TTC | Phenylalanine | Phe |
| TTA | Leucine | Leu |
| TTG | Leucine | Leu |
How wide is DNA?
A DNA strand is a long, thin molecule—averaging only about two nanometers (or two billionths of a meter) in width. That is so thin, that a human hair is about 40,000 times as wide.
What amino acid is UGA?
The results show that UAA, like UAG, directs the incorporation of glutamine, whereas UGA directs the incorporation of three amino acids, arginine, cysteine, and tryptophan. To our knowledge, this is the first report indicating misreading of UAA as glutamine and UGA as arginine and cysteine in higher eukaryotes.
What is mRNA translation?
Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a sequence of amino acids during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding amino acid sequence that it encodes.
What is the size of RNA?
According to the length of RNA chain, RNA includes small RNA and long RNA. Usually, small RNAs are shorter than 200 nt in length, and long RNAs are greater than 200 nt long.
What is the complementary three nucleotide sequence in the appropriate tRNA?
The anticodon is the complementary three nucleotide sequence in the appropriate tRNA. b. Template strand is the DNA strand off which the mRNA is synthesized. The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.
What is the corresponding anti-codon to the mRNA sequence?
The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’ (the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T) d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’ 2.
What is the sequence of the mRNA?
The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’ (the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
How to find transcript sequences for a gene?
National Center for Biotechnology Information. How to: Find transcript sequences for a gene. Starting with A GENE NAME, PRODUCT NAME, OR SYMBOL. Search the Gene database with the gene name, symbol. Click on the desired gene. Click on Reference Sequences in the Table of Contents at the upper right of the gene record.